• +91 9971497814
  • info@interviewmaterial.com

Chapter 6- वंशागति का आणविक आधार (Molecular Basis of Inheritance) Interview Questions Answers

Related Subjects

Question 1 : निम्न को नाइट्रोजनीकृत क्षार व न्यूक्लिओटाइड के रूप में वर्गीकृत कीजिए-एडेनीन, साइटीडीन, थाइमीन, ग्वानोसीन, यूरेसील व साइटोसीन।

Answer 1 :

नाइट्रोजनीकृत क्षार – एडेनीन, थाइमीन, यूरेसील, साइटोसीन।
न्यूक्लिओटाइड – साइटीडीन, ग्वानोसीन।

Question 2 : यदि एक द्विरज्जुक DNA में 20 प्रतिशत साइटोसीन है तो DNA में मिलने वाले एडेनीन के प्रतिशत की गणना कीजिए।

Answer 2 :

चारग्राफ के नियमानुसार द्विरज्जुक DNA में →A + G = T + C = 1 होता है। अर्थात् एडेनीन = थाइमीन,
ग्वानिन = साइटोसीन
चूँकि साइटोसीन की दी गई मात्रा 20% है तो ग्वानिन भी 20% होगा।
ग्वानिन + साइटोसीन = 20 + 20 = 40%
A + G = 100 – 40%
A + G = 60%
चूँकि A = G होता है; अत: एडेनीन की मात्रा = 60/2 = 30% होगी।

Question 3 :
यदि डी०एन०ए० के एकरज्जुक के अनुक्रम निम्नवत् लिखे हैं –
5′ – ATGCATGCATGCATGCATGCATGCATGC – 3′
तो पूरक रज्जुक के अनुक्रम को 5 → 3 दिशा में लिखिए।

Answer 3 :

डी०एन०ए० द्विकुण्डली संरचना होती है अर्थात् यह दो पॉलिन्यूक्लियोटाइड श्रृंखलाओं (polynucleotide chains) से बना होता है। दोनों श्रृंखलाएँ प्रतिसमानान्तर ध्रुवणता रखती हैं। इसका तात्पर्य है यदि एक श्रृंखला की ध्रुवणता 5 से 3′ की ओर हो तो दूसरे की ध्रुवणता 3 से 5′ की तरफ होगी।
दोनों श्रृंखलाओं के नाइट्रोजनी क्षार परस्पर हाइड्रोजन बन्ध (bonds) द्वारा जुड़े रहते हैं। ऐडेनीन दो हाइड्रोजन बन्ध द्वारा थाइमीन (A = T) से और साइटोसीन तीन हाइड्रोजन बन्ध द्वारा ग्वानीन (C ≡ G) से जुड़े होते हैं। इसके फलस्वरूप प्यूरीन (purine) के विपरीत दिशा में पिरिमिडीन (pyrimidine) होता है। इससे डी०एन०ए० द्विकुण्डली के दोनों पॉलिन्यूक्लियोटाइड के मध्य समान दूरी बनी रहती है। अतः डी०एन०ए० के पूरक रज्जुक (श्रृंखला) में नाइट्रोजनीकृत क्षार का अनुक्रम निम्नवत् होगा –
5′ – ATGCATGCATGCATGCATGCATGCATGC-3′
3′ – TACGTACGTACGTACGTACGTACGTACG-5′

Question 4 :
यदि अनुलेखन इकाई में कूट लेखन रज्जुक के अनुक्रम को निम्नवत् लिखा गया है –
5′ – ATGCATGCATGCATGCATGCATGCATGC – 3′
तो दूत-आर०एन०ए० के अनुक्रम को लिखिए।

Answer 4 :

आर०एन०ए० का निर्माण डी०एन०ए० से होता है। आर०एन०ए० सामान्यतया एकरज्जुकी संरचना (single strand structure) होती है। इसमें थाइमीन नाइट्रोजनीकृत क्षार के स्थान पर यूरेसिल (uracil) पाया जाता है। डी०एन०ए० का एकरज्जुक (अनुलेखन इकाई) से आनुवंशिक सूचनाओं का दूत-आर०एन०ए० (m-R.N.A.) में प्रतिलिपिकरण करने की प्रक्रिया अनुलेखन (transcription) कहलाती है।
यदि कूटलेखन रज्जुक (coding strand) के अनुक्रम निम्नवत् हैं –
5′ – ATGCATGCATGCATGCATGCATGCATGC – 3’।
तो दूत-आर०एन०ए० (m-R.N.A.) के अनुक्रम निम्नवत् होंगे –
5′ – AUGCAUGCAUGCAUGCAUGCAUGCAUGC – 3′

Question 5 : DNA ढिकुंडली की कौन-सी विशेषता ने वाटसन व क्रिक को DNA प्रतिकृति के सेमी कंजर्वेटिव रूप को कल्पित करने में सहयोग किया? इसकी व्याख्या कीजिए।

Answer 5 :

वाटसन व क्रिक ने DNA का द्विकुंडली मॉडल दिया था। इस मॉडल की मुख्य विशेषता पॉलीन्यूक्लिओटाइड श्रृंखलाओं के बीच युग्मन का होना था। पॉलीन्यूक्लिओटाइड श्रृंखलाओं में क्षार युग्मन ही एक ऐसी विशेषता थी जिसने वाटसन व क्रिक को DNA प्रतिकृति के सेमी कंजर्वेटिव रूप को कल्पित करने में सहयोग किया था। क्षार-युग्मन के इसी गुण के आधार पर श्रृंखलाएँ एक-दूसरे की पूरक बनती हैं अर्थात् एक DNA रज्जुक में क्षार अनुक्रम पता होने पर दूसरे रज्जुक के क्षार युग्मन को ज्ञात किया जा सकता है।
इसके अतिरिक्त DNA का प्रत्येक रज्जुक, नये DNA रज्जुक के संश्लेषण हेतु साँचे का कार्य करता है। इस साँचे से बना द्विकुंडलित DNA अपने जनक DNA के समरूप होता है। DNA प्रतिकृतिकरण की सेमी कंजर्वेटिव पद्धति में DNA के दोनों रज्जुक पृथक् होकर नये रज्जुक के संश्लेषण हेतु साँचे के समान कार्य करते हैं। DNA प्रतिकृति में एक जनक रज्जुक व एक नया रज्जुक होता है।

Question 6 : टेम्पलेट (डी०एन०ए० या आर०एन०ए०) की रासायनिक प्रकृति व इससे (डी०एन०ए० या आर०एन०ए०) संश्लेषित न्यूक्लीक अम्लों की प्रकृति के आधार पर न्यूक्लीक अम्ल पॉलिमरेज के विभिन्न प्रकार की सूची बनाइए।

Answer 6 :

न्यूक्लीक अम्ल पॉलिमरेज निम्नलिखित प्रकार के होते हैं –
1. डी०एन०ए० पॉलिमरेज (D.N.A. polymerase) एन्जाइम प्रतिकृति (replication) के लिए आवश्यक है। यह डी०एन०ए० टेम्पलेट का उपयोग डि-ऑक्सीन्यूक्लियोटाइड के बहुलकन (polymerisation) को प्रेरित करने के लिए करता है। डी०एन०ए० अणुओं की दोनों श्रृंखलाएँ एकसाथ पृथक् नहीं होतीं। डी०एन०ए० द्विकुण्डली प्रतिकृति हेतु छोटे-छोटे भागों में खुलती है। इसके फलस्वरूप बनने वाले खण्ड परस्पर डी०एन०ए० लाइगेज (D.N.A. ligase) एन्जाइम द्वारा जुड़ जाते हैं। डी०एन०ए० पॉलिमरेज स्वयं प्रतिकृति प्रक्रम का प्रारम्भ नहीं कर सकते। यह कुछ निश्चित स्थल पर संवाहक (vector) की सहायता से होती है।
2. आर०एन०ए० पॉलिमरेज (R.N.A. polymerase) – यह डी०एन०ए० पर निर्भर आर०एन०ए० पॉलिमरेज (D.N.A. dependent R.N.A. polymerase) होता है। यह D.N.A. को सभी प्रकार के आर०एन०ए० के अनुलेखन (transcription) के लिए उत्प्रेरित करता है। आर०एन०ए० पॉलिमरेजे अस्थायी रूप से प्रारम्भन कारक या समापन कारक से जुड़कर अनुलेखन का प्रारम्भ या समापन करता है। केन्द्रक में डी०एन०ए० पर निर्भर आर०एन०ए० पॉलिमरेज के अतिरिक्त निम्नलिखित तीन प्रकार के आर०एन०ए० पॉलिमरेज मिलते हैं –
1. आर०एन०ए० पॉलिमरेज I – यह राइबोसोमल आर०एन०ए० (r-R.N.A.) को अनुलेखित (transcribes) करता है।
2. आर०एन०ए० पॉलिमरेज III – यह ट्रान्सफर आर०एन०ए० (t-R.N.A.) तथा छोटे केन्द्रकीय आर०एन०ए० के अनुलेखन के लिए उत्तरदायी होता है।
3. आर०एन०ए० पॉलिमरेज II – यह सन्देशवाहक आर०एन०ए० (m-R.N.A.) के पूर्ववर्ती विषमांगी केन्द्रकीय आर०एन०ए० (heterogenous nuclear R.N.A.-hnR.N.A.) का अनुलेखन करता है।

Question 7 : DNA आनुवंशिक पदार्थ है, इसे सिद्ध करने हेतु अपने प्रयोग के दौरान हर्णे व चेज ने DNA व प्रोटीन के बीच कैसे अंतर स्थापित किया?

Answer 7 : हशें वे चेज ने DNA को आनुवंशिक पदार्थ सिद्ध करने हेतु P32 व P32 आइसोटॉप्स युक्त माध्यम, में ई० कोलाई जीवाणु का संवर्द्धन कराया। कुछ समय वृद्धि करने के पश्चात् जीवाणु को जीवाणुभोजी द्वारा संक्रमित कराया गया। संक्रमण के पश्चात् देखा गया कि जीवाणुभोजी का प्रोटीन आवरण S35 रेडियोधर्मी युक्त हो गया था जबकि इसके DNA में सल्फर नहीं होता। इसके विपरीत जीवाणुभोजी का DNA P32 रेडियोधर्मी आइसोटॉप्स की उपस्थिति दिखा रहा था, क्योंकि DNA में

फॉस्फोरस होता है। प्रोटीन आवरण में P32 अनुपस्थित था। P32 रेडियोधर्मी युक्त जीवाणुभोजी द्वारा ऐसे जीवाणु को संक्रमित कराया गया जिसमें रेडियोधर्मी तत्त्व नहीं थे। संक्रमण के पश्चात् देखा गया कि समस्त जीवाणु रेडियोधर्मी हो गये थे। अधिकांश रेडियोधर्मी आइसोटॉप्स जीवाणुभोजी की अगली पीढ़ी में भी स्थानांतरित हो गये थे।
रेडियोधर्मी तत्त्व रहित जीवाणुओं में S32 युक्त जीवाणुभोजी द्वारा संक्रमण कराने पर तथा जीवाणुभोजी पृथक् करने पर देखा गया कि जीवाणुओं में रेडियोधर्मी तत्त्व मौजूद नहीं थे बल्कि ये जीवाणुभोजी के प्रोटीन आवरण में ही रह गये थे। उपरोक्त प्रयोग सिद्ध करता है कि जीवाणुभोजी का DNA ही वह पदार्थ है जो नये जीवाणुभोजी उत्पन्न करता है व संक्रमण में भाग लेता है। यह सिद्ध हो गया कि DNA आनुवंशिक पदार्थ है, प्रोटीन नहीं। इसके अतिरिक्त DNA फॉस्फोरस युक्त होता है जबकि प्रोटीन में फॉस्फोरस नहीं होता है। DNA सल्फर रहित होता है, जबकि प्रोटीन, सल्फर युक्त होता है।

Question 8 :
निम्न के बीच अंतर बताइए –
(क) पुनरावृत्ति DNA एवं अनुषंगी DNA
(ख) mRNA और tRNA
(ग) टेम्पलेट रज्जु और कोडिंग रज्जु

Answer 8 : (क) पुनरावृत्ति DNA एवं अनुषंगी DNA में अंतर

(एमआरएनए और टीआरएनए में अंतर
(टेम्पलेट रज्जु और कोडिंग रज्जु में अंतर

Question 9 : स्थानान्तरण के दौरान राइबोसोम की दो मुख्य भूमिकाओं की सूची बनाइए।

Answer 9 : स्थानान्तरण (Translation) – इस प्रक्रिया में ऐमीनो अम्लों के बहुलकन (polymerisation) से पॉलिपेप्टाइड का निर्माण होता है। ऐमीनो अम्लों के क्रम अनुक्रम सन्देशवाहक आर०एन०ए० में पाए जाने वाले क्षारों के अनुक्रम पर निर्भर करते हैं। ऐमीनो अम्ल पेप्टाइड बन्ध (peptide bonds) द्वारा जुड़े रहते हैं। स्थानान्तरण प्रक्रिया पूर्ण होने पर पॉलिपेप्टाइड श्रृंखला राइबोसोम से पृथक् हो जाती है।

स्थानान्तरण में राइबोसोम की भूमिका
1. राइबोसोम का छोटा सबयूनिट m-R.N.A. के प्रथम कोडॉन (AUG) के साथ बन्धित होकर समारम्भ कॉम्प्लैक्स (initiation complex) ऐमीनो ऐसिल t-R.N.A. बनाता है जिसकी पहचान प्रारम्भक t-R.N.A. द्वारा की जाती है। ऐमीनो अम्ल t-R.N.A. से जुड़कर एक जटिल रचना बनाते हैं जो आगे चलकर t-R.N.A. के प्रति प्रकूट (anticodon) से पूरक क्षार युग्म बनाकर m-R.N.A. के उचित आनुवंशिक कोडॉन से जुड़ जाती है।
2. राइबोसोम के बड़े सबयूनिट पर t-R.N.A. अणुओं के जुड़ने के लिए दो खाँच होती हैं, इन्हें P-site या दाता स्थल और A-site या ग्राही स्थल कहते हैं। P-site (दाता-स्थल) पर पॉलिपेप्टाइड श्रृंखला को धारण करने वाला t-R.N.A. जुड़ता है। A-site (ग्राही स्थल) पर ऐमीनो ऐसिल t-R.N.A. जुड़ता है। बड़े सबयूनिट के पेप्टाइड सिन्थेटेज (peptide synthetase) एन्जाइम पॉलिपेप्टाइड श्रृंखला के ऐमीनो अम्ल के -COOH तथा ऐमीनो ऐसिल t-R.N.A. के ऐमीनो अम्ल के – NH, के मध्य पेप्टाइड बन्ध बनाता है।

Question 10 : उस संवर्धन में जहाँ ई० कोलाई वृद्धि कर रहा हो लैक्टोस डालने पर लैक-ओपेरॉन उत्प्रेरित होता है, तब कभी संवर्धन में लैक्टोस डालने पर लैक-ओपेरॉन कार्य करना क्यों बन्द कर देता है?

Answer 10 :

ओपेरॉन संकल्पना
मनुष्य की आँत में पाए जाने वाले जीवाणु ई० कोलाई सामान्यतया लैक्टोस के अपचय से ऊर्जा प्राप्त करते हैं। जैकब एवं मोनोड (Jacob & Monod, 1961) ने पता लगाया कि इसके D.N.A. में तीन जीन का एक समूह लैक्टोस का अपचय करने वाले तीन एन्जाइम्स के संश्लेषण से सम्बन्धित होता है। पोषण माध्यम में लैक्टोस होता है तो ये जीन सक्रिय होते हैं। पोषण माध्यम में लैक्टोस के अभाव में ये निष्क्रिय रहते हैं। जैकब एवं मोनोड ने इस जीन की सक्रियता के नियमन के लिए ओपेरॉन संकल्पना (operon concept) प्रस्तुत की।
ओपेरॉन संकल्पना के अनुसार जीन की सक्रियता का नियमन अनुलेखन स्तर पर प्रेरण या दमन (induction or repression) द्वारा होता है। लैक्टोस का अपचय करने वाले एन्जाइम्स β –गैलेक्टोसाइडेज (β-galactosidase), गैलेक्टोस परमीएज (galactose permease) तथा थायोगैलेक्टोसाइडेज ट्रान्सऐसीटिलेज (thiogalactosidase transacetylase) हैं। इनके संरचनात्मक जीन्स (structural genes) को क्रमशः सिस्ट्रॉन-z, सिस्ट्रॉन-y तथा सिस्ट्रॉन-a द्वारा प्रदर्शित करते हैं। ये एक-दूसरे के निकट स्थित होते हैं। इनमें परस्पर समन्वय होता है।
तीन जीन इनको कन्ट्रोल करते हैं, इन्हें रेगुलेटर जीन (regulator gene), प्रोमोटर जीन (promoter gene) तथा ओपरेटर जीन (operator gene) कहते हैं। किसी उपापचयी तन्त्र में एन्जाइम्स को कोड करने वाले जीन सामान्यतया समूह (cluster) के रूप में गुणसूत्र पर स्थित होती हैं। ये एक कार्यक जटिल (functional complex) बनाती हैं। इस पूरे तन्त्र को लैक ओपेरॉन कहते हैं। इसमें संरचनात्मक जीन (structural genes), प्रोमोटर जीन (promoter gene), ओपरेटर जीन (operator gene) तथा रेगुलेटर जीन (regulater gene) आदि मिलती हैं।
लैक ओपेरॉन = रेगुलेटर जीन + प्रोमोटर जीन + ओपेरेटर जीन + संरचनात्मक जीन लैक ओपेरॉन का प्रकार्य
(A) लैक्टोस की अनुपस्थिति में (In absence of Lactose) – लैक्टोस प्रेरक की अनुपस्थिति में
रेगुलेटर जीन एक लैक निरोधक या दमनकारी प्रोटीन बनाता है। यह ओपरेटर जीन से बन्धित होकर इसके अनुलेखन को रोकता है। इसके फलस्वरूप संरचनात्मक जीन m-R.N.A.